Nature, Volume 427Sir Norman Lockyer Macmillan Journals Limited, 2004 - Electronic journals |
From inside the book
Results 1-3 of 81
Page 83
... containing 5 μM forskolin and 0.5 % fetal bovine serum ( FBS ) for 1 week . Rat NSCs were cultured in N2 medium containing FGF2 ( 20 ng ml ' ) as described's . Neural differentiation was initiated with N2 supplemented medium containing ...
... containing 5 μM forskolin and 0.5 % fetal bovine serum ( FBS ) for 1 week . Rat NSCs were cultured in N2 medium containing FGF2 ( 20 ng ml ' ) as described's . Neural differentiation was initiated with N2 supplemented medium containing ...
Page 442
... containing a headspace with 2 × 10 atm O2 ( 2μM dissolved ) , a slow decrease in culture viability was observed , and this decrease was more rapid with a greater concen- tration of O2 ( Fig . 1a ) . By contrast , B. fragilis cells grew ...
... containing a headspace with 2 × 10 atm O2 ( 2μM dissolved ) , a slow decrease in culture viability was observed , and this decrease was more rapid with a greater concen- tration of O2 ( Fig . 1a ) . By contrast , B. fragilis cells grew ...
Page 861
... containing the promoter and the first two nucleotides of the OXII coding sequence was amplified from genomic DNA by PCR with the primers 5 ' - GCGCGGATCCCGCTGGGATAATCTCAAAGG - 3 ′ and 5 ' - CGCGCTGCAGATAA TGTCGACGTTAGTTAAC - 3 ' , and ...
... containing the promoter and the first two nucleotides of the OXII coding sequence was amplified from genomic DNA by PCR with the primers 5 ' - GCGCGGATCCCGCTGGGATAATCTCAAAGG - 3 ′ and 5 ' - CGCGCTGCAGATAA TGTCGACGTTAGTTAAC - 3 ' , and ...
Other editions - View all
Common terms and phrases
acid activation analysis ANKTM1 antibody applications assays Astron Astrophys Biol biology Ca2+ Cancer candidate carbon Cell Biology Centre chromosome climate complex core crystal Department detected domain e-mail effect electron embryos experience expression formation FtsY function fusion loop galaxies gene genetic genome germ cells global globular cluster GTPase Hipparcos histone human imaging indicate Institute interactions interface kinase Laboratory Landau level magnesite magnetic Markuelia membrane molecular molecules mutant nature publishing group Naturejobs Notch Notch signalling observed orbital paracaspase pathway peptide phase Phys position postdoctoral programme protein quantum quantum dot receptor region residues sample scientific scientists sequence signal siRNA species star stem cells structure supernova supersolid Supplementary Information surface target Technology temperature translocation trimer ubiquitination University velocity vernalization VIN3 vinculin virus Vycor www.nature.com/nature